Netherlands Proteomics Centre
► Login
Blighted by Kenning

Blighted by Kenning

In 2012 The UK artist Charlotte Jarvis and the Netherlands Proteomics Centre (NPC) collaborated on a bio-art project called 'Blighted by Kenning'.

About the project
The project has bio-engineerd a bacteria which has the Universal Declaration of Human rights encoded into its DNA sequence. The DNA has been extracted and apples grown near The Hague, which houses the International Court of Justice, have been 'contaminated' with the synthetic DNA. They have been sent to genomics laboratories around the world, which have been asked to sequence the declaration and also eat the fruit.

 

The process for using the DNA sequence as a code to represent natural text is well established. Each letter of the alphabet will be represented by a codon - a tri-nucleotide unit consisting of a specific combination of Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). In nature most codons already correspond to one of 20 amino acid, each of which is designated by a single letter of the alphabet. For example, 'Article One' could be written into the genome as ‘GCTCGTACTATTTGTTTAGAAAGAATAAATGAA’. Because not all letters are represented by amino acids, but some amino acids are encoded by multiple codons, we will slightly adapt the meaning of some codons. In the sequence above, the codon AGA is used to designate a space and the codon ATA is used for the letter “O”, which has no associated amino acid.

The piece is envisaged as a performance in which an idea is biologically, literally, spread across the world. It is hoped that the project will create an international network of genomics institutes and a purposeful spreading of genetically engineered material. It is this 'contamination' that interests us; a realisation of the concept that ideas can be infectious.

The piece uses genomics to address the role of the Netherlands, specifically The Hague, as a symbol for the idea of global morality, of ethics that are intrinsic to our humanity. This is particularly relevant to the media controversies surrounding genomics research. The advancement of science and technology, especially genetics, is so often feared as a challenge to our humanity. Knowledge in this case is perceived as dangerous, unnatural, even lethal. The significance of this project is that it attempts to create an alternative scenario in which science and technology palpably propagate our humanitiy’s most highly valued achievements. It is apt that this message would come from The Hague.

Funding
Blighted by Kenning was funded by the Netherlands Proteomics Centre and the Netherlands Genomics Initiative.

Exhibition
The project was on view from November 15th - December 6th 2012 at Hotel Droog, Amsterdam.
The exhibition was organised in cooperation with CSG Centre for Society and the Life Sciences and was part of Shaking Science! 30 days life sciences and society in conversation.

Please take a moment to view the brief documentary on the project.

Blighted By Kenning: Apples Infected with Knowledge from Charlotte Jarvis on Vimeo.

Bio-art : Blighted by Kenning

Contact      Telephone   +31 30 253 45 64      |      Fax   +31 30 253 69 18      |      Email   info@npc.genomics.nl      |      Privacy settings