Blighted by Kenning

A work in progress in collaboration with Charlotte Kay Jarvis.

The project proposes to bio-engineer a fungus which has the Universal Declaration of Human Rights encoded into its DNA sequence. Apples grown near The Hague will be infected with the fungus. They will be sent to genomics laboratories around the world, which will be asked to sequence the declaration and eat the fruit. It is up to the scientists themselves if they should choose to do this. The artist will eat one of the apples at the opening.

Blighted by Kenning is in the development stage. The project was presented at the NPC Progress Meeting on Feb 7th 2012. The completed project will be exhibited at The Big Shed in Suffolk in July. The exhibition will be curated by Clemency Cooke.

Blighted by Kenning is funded by the NPC and The Netherlands Genomics Initiative (NGI).

The process for using the DNA sequence as a code to represent natural text is well established. Each letter of the alphabet will be represented by a codon - a tri-nucleotide unit consisting of a specific combination of Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). In nature most codons already correspond to one of 20 amino acid, each of which is designated by a single letter of the alphabet. For example, 'Article One' could be written into the genome as ‘GCTCGTACTATTTGTTTAGAAAGAATAAATGAA’. Because not all letters are represented by amino acids, but some amino acids are encoded by multiple codons, we will slightly adapt the meaning of some codons. In the sequence above, the codon AGA is used to designate a space and the codon ATA is used for the letter “O”, which has no associated amino acid.

The piece is envisaged as a performance in which an idea is biologically, literally, spread across the world. It is hoped that the project will create an international network of genomics institutes and a purposeful spreading of genetically engineered material. It is this 'contamination' that interests us; a realisation of the concept that ideas can be infectious.

The piece uses genomics to address the role of the Netherlands, specifically The Hague, as a symbol for the idea of global morality, of ethics that are intrinsic to our humanity. This is particularly relevant to the media controversies surrounding genomics research. The advancement of science and technology, especially genetics, is so often feared as a challenge to our humanity. Knowledge in this case is perceived as dangerous, unnatural, even lethal. The significance of this project is that it attempts to create an alternative scenario in which science and technology palpably propagate our humanitiy’s most highly valued achievements. It is apt that this message would come from The Hague.