Blighted by Kenning
The UK artist Charlotte Jarvis and the Netherlands Proteomics Centre (NPC) have been collaborating on a bio-art project called 'Blighted by Kenning'.
The project has bio-engineerd a bacteria which has the Universal Declaration of Human rights encoded into its DNA sequence. The DNA has been extracted and apples grown near The Hague, which houses the International Court of Justice, have been 'contaminated' with the synthetic DNA. They have been sent to genomics laboratories around the world, which have been asked to sequence the declaration and also eat the fruit.
The process for using the DNA sequence as a code to represent natural text is well established. Each letter of the alphabet will be represented by a codon - a tri-nucleotide unit consisting of a specific combination of Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). In nature most codons already correspond to one of 20 amino acid, each of which is designated by a single letter of the alphabet. For example, 'Article One' could be written into the genome as ‘GCTCGTACTATTTGTTTAGAAAGAATAAATGAA’. Because not all letters are represented by amino acids, but some amino acids are encoded by multiple codons, we will slightly adapt the meaning of some codons. In the sequence above, the codon AGA is used to designate a space and the codon ATA is used for the letter “O”, which has no associated amino acid.

The
piece is envisaged as a performance in which an idea is biologically,
literally, spread across the world. It is hoped that the project will
create an international network of genomics institutes and a purposeful
spreading of genetically engineered material. It is this 'contamination'
that interests us; a realisation of the concept that ideas can be
infectious.
The piece uses genomics to address the role of the Netherlands,
specifically The Hague, as a symbol for the idea of global morality, of
ethics that are intrinsic to our humanity. This is particularly relevant
to the media controversies surrounding genomics research. The
advancement of science and technology, especially genetics, is so often
feared as a challenge to our humanity. Knowledge in this case is
perceived as dangerous, unnatural, even lethal. The significance of this
project is that it attempts to create an alternative scenario in which
science and technology palpably propagate our humanitiy’s most highly
valued achievements. It is apt that this message would come from The
Hague.
Blighted by Kenning is funded by the Netherlands Proteomics Centre and the Netherlands Genomics Initiative.
The project is on view from November 15th - December 6th at Hotel Droog, Amsterdam.
The exhibition is organised in cooperation with CSG Centre for Society and the Life Sciences and is part of Shaking Science! 30 days life sciences and society in conversation.
Please take a moment to view the brief documentary on the project.
Blighted By Kenning: Apples Infected with Knowledge from Charlotte Jarvis on Vimeo.
